Skip Navigation
NCI banner National Cancer Institute U.S. National Institutes of Health National Cancer Institute
Tissues
  • Tools
  • SNPs by tissue
  • CGAP Data
Cancer Genome Characterization Initiative

Visit the database of genomic characterization data for multiple tumor types.


Library Info Page


Library ID

Library Name:No3 mouse (cataract/retinal degeneration) whole eye, unamplified: ob/oc
Organism:Mus musculus
Strain:No3 (C3H background)
UniGene Library ID:16932
Tissue Description:
Library Keywords:eye, adult, EST, plasmid vector, directionally cloned, cataract

Clones and Sequences

#Clones Generated to Date:
#Sequences Generated to Date:4829

Library Preparation Details

Description:Approximately 1mg total RNA was extracted from 100 adult mouse whole eyes. A directionally cloned cDNA library in the pCMVSPORT6 vector (Invitrogen) was constructed at Bioserve Biotechnology (Laurel MD) essentially following the protocols of the SuperScript Plasmid System full details of which are contained in the manufacturer's Instruction manual (http://www.lifetech.com/). First strand synthesis was carried out using a Not I primer-adapter [5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)15-3']. cDNA was cloned in Not I/Sal I sites. EST analysis was performed on the unamplified library at the NIH Intramural Sequencing Center (NISC).
R. Site1:
R. Site2:
Lab Host:EMDH10B
Vector:pCMVSport6
Vector Type:Plasmid
Tissue Supplier:
Library Producer: