Skip Navigation
NCI banner National Cancer Institute U.S. National Institutes of Health National Cancer Institute
Tissues
  • Tools
  • SNPs by tissue
  • CGAP Data
Cancer Genome Characterization Initiative

Visit the database of genomic characterization data for multiple tumor types.


Library Info Page


Library ID

Library Name:NIH_MGC_256
Organism:Mus musculus
Strain:
UniGene Library ID:16177
Tissue Description:Oocytes, mouse, C57B16/J
Library Keywords:normal, non-normalized, bulk, EST, MGC, oocyte, size fractionated, plasmid vector, directionally cloned, oligo-dT primed, primary oocyte

Clones and Sequences

#Clones Generated to Date:4992
#Sequences Generated to Date:4487

Library Preparation Details

Description:cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >0.5 kb resulted in an average insert size of 1.2 kb. This is a primarylibrary (normalized primary library is NIH_MGC_257) and was constructed by Express Genomics (Frederick, MD). Note: this is a NIH_MGC library
R. Site1:EcoRV
R. Site2:NotI
Lab Host:DH10B TonA
Vector:pExpress-1
Vector Type:plasmid
Tissue Supplier:Dr. Kathleen Horner, Stanford University
Library Producer:Express Genomics