Skip Navigation
NCI banner National Cancer Institute U.S. National Institutes of Health National Cancer Institute
Tissues
  • Tools
  • SNPs by tissue
  • CGAP Data
Cancer Genome Characterization Initiative

Visit the database of genomic characterization data for multiple tumor types.


Library Info Page


Library ID

Library Name:NIH_MGC_189
Organism:Mus musculus
Strain:
UniGene Library ID:15413
Tissue Description:Thyroid, mouse (Black Swiss/Taconic), 4-5 weeks, normal wild-type, pooled from 5 mice
Library Keywords:thyroid, normal, bulk, normalized, juvenile, EST, MGC, size fractionated, plasmid vector, oligo-dT primed

Clones and Sequences

#Clones Generated to Date:4992
#Sequences Generated to Date:4612

Library Preparation Details

Description:RNA obtained from 5 normal wild-type mice. cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection 1.4 kb resulted in an average insert size of 1.2 kb. This primary, nanoquantity library is normalized to Cot5 (non-normalized primary library is NIH_MGC_230) and was constructed by Express Genomics (Frederick, MD). Note: this is a NIH_MGC library
R. Site1:NotI
R. Site2:NotI
Lab Host:DH10B TonA
Vector:pExpress-1
Vector Type:plasmid
Tissue Supplier:Shioko Kimura/Atsushi Yamada, (NCI,CCR)
Library Producer:Express Genomics