Skip Navigation
NCI banner National Cancer Institute U.S. National Institutes of Health National Cancer Institute
Tissues
  • Tools
  • SNPs by tissue
  • CGAP Data
Cancer Genome Characterization Initiative

Visit the database of genomic characterization data for multiple tumor types.


Library Info Page


Library ID

Library Name:Mouse lacrimal gland, unamplified: ou
Organism:Mus musculus
Strain:C57Bl6
UniGene Library ID:15225
Tissue Description:
Library Keywords:normal, bulk, adult, EST, male, lacrimal gland, plasmid vector, C57BL/6

Clones and Sequences

#Clones Generated to Date:
#Sequences Generated to Date:1407

Library Preparation Details

Description:RNA was extracted from 75 adult male mouse lacrimal glands. A directionally cloned cDNA library in the pCMVSPORT6 vector(Life Technologies) was constructed at Bioserve Biotechnology (Laurel MD) essentially following the protocols of the SuperScript Plasmid System full details of which are contained in the manufacturer's Instruction manual (http://www.lifetech.com/). First strand synthesis was carried out using a Not I primer-adapter [5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)15-3']. EST analysis was performed on the unamplified library at the NIH Intramural Sequencing Center (NISC).
R. Site1:
R. Site2:
Lab Host:EMDH10B
Vector:pCMVSport6
Vector Type:Plasmid
Tissue Supplier:
Library Producer: