Skip Navigation
NCI banner National Cancer Institute U.S. National Institutes of Health National Cancer Institute
  • Tools
  • SNPs by tissue
  • CGAP Data
Cancer Genome Characterization Initiative

Visit the database of genomic characterization data for multiple tumor types.

Library Info Page

Library ID

Library Name:NIH_MGC_204
Organism:Mus musculus
UniGene Library ID:14412
Tissue Description:Placenta, mouse, C57 Black/ 6 Ncr, 16th day of pregnancy
Library Keywords:normal, placenta, bulk, pregnant, adult, normalized, EST, MGC, female, plasmid vector

Clones and Sequences

#Clones Generated to Date:1920
#Sequences Generated to Date:1588

Other Libraries from Same Tissue Sample


Library Preparation Details

Description:RNA obtained from three placentas from female C57/BL6 mouse at 16 days pregnancy. Tissues were snap-frozen and kept at -80C for two days before RNA extraction and purification (Tri-reagent method). cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >0.75kb resulted in an average insert size of 1.1 kb. This primary, nanoquantity library is normalized to Cot5 (non-normalized primary library is NIH_MGC_223) and was constructed by Express Genomics (Frederick, MD).
R. Site1:EcoRV
R. Site2:NotI
Lab Host:DH10B (phage-resistant)
Vector Type:plasmid (ampicillin resistant)
Tissue Supplier:Naryan Bhat
Library Producer:Express Genomics