Skip Navigation
NCI banner National Cancer Institute U.S. National Institutes of Health National Cancer Institute
Tissues
  • Tools
  • SNPs by tissue
  • CGAP Data
Cancer Genome Characterization Initiative

Visit the database of genomic characterization data for multiple tumor types.


Library Info Page


Library ID

Library Name:NIH_MGC_164
Organism:Mus musculus
Strain:
UniGene Library ID:12373
Tissue Description:Jaw bone, mouse, day 10.5 to 11.5 (CD-1), developing maxilla and mandibula tissue containing undifferentiated progenitor cells for muscle, dermis, epidermis, skin, membraneous bone, cartilage and teeth
Library Keywords:normal, non-normalized, bulk, full-length enriched, EST, MGC, embryonic tissue, size fractionated, directionally cloned, phagemid, oligo-dT primed, organogenesis

Clones and Sequences

#Clones Generated to Date:9984
#Sequences Generated to Date:8822

Library Preparation Details

Description:Non-normalized full-length enriched library from pooled mouse embryonic limb, maxilla and mandible, day 10.5 and 11.5 (size selected for the 0.5-1 kb fragments) Cloned directionally, priming method: Oligo-dT. cDNA enrichment: >1k bp, Average insert size 1.8k bp. Priming sequence: 5'GACTAGTTCTAGATCGCGAGCGGCCGCCC(T) 3'. Tissue contributed by, David Rowe. Library constructed by ResGen, Invitrogen Corp.
R. Site1:EcoRV
R. Site2:NotI
Lab Host:DH10B (phage-resistant)
Vector:pCMV-SPORT6.1
Vector Type:phagemid (ampicillin resistant)
Tissue Supplier:Dr. David Rowe and Dr. Mina
Library Producer:Invitrogen Corp