Skip Navigation
NCI banner National Cancer Institute U.S. National Institutes of Health National Cancer Institute
Tissues
  • Tools
  • SNPs by tissue
  • CGAP Data
Cancer Genome Characterization Initiative

Visit the database of genomic characterization data for multiple tumor types.


Library Info Page


Library ID

Library Name:NIH_MGC_135
Organism:Mus musculus
Strain:
UniGene Library ID:12615
Tissue Description:Jaw and Limb, mouse, day 12.5 thru day 15.5, pool of developing fore and hind limbs, maxilla, mandibule, containing differentiating muscle, dermis, epidermis, tendon, early forming joints, cartilage, Meckel's cartilage, tooth bud, early membraneous bone.
Library Keywords:fetus, normal, bulk, normalized, full-length enriched, EST, LTI normalized, MGC, embryonic tissue, size fractionated, directionally cloned, phagemid, oligo-dT primed

Clones and Sequences

#Clones Generated to Date:10752
#Sequences Generated to Date:9199

Library Preparation Details

Description:Normalized full-length enriched library from pooled mouse embryonic limb, maxilla and mandible, day 12.5, 13.5, 14.5, and 15.5 (size selected for the 0.5-1 kb fragments) Cloned directionally, priming method: Oligo-dT. cDNA enrichment: >1k bp, Average insert size 1.6k bp. Normalization (Cot value): 7.5 kb. Priming sequence: 5'GACTAGTTCTAGATCGCGAGCGGCCGCCC(T)3' Tissue contributed by, David Rowe. Library constructed by ResGen, Invitrogen Corp.
R. Site1:EcoRV
R. Site2:NotI
Lab Host:DH10B (phage-resistant)
Vector:pCMVSport6.1
Vector Type:phagemid (ampicillin resistant)
Tissue Supplier:Dr. David Rowe
Library Producer:Invitrogen Corp