Skip Navigation
NCI banner National Cancer Institute U.S. National Institutes of Health National Cancer Institute
Tissues
  • Tools
  • SNPs by tissue
  • CGAP Data
Cancer Genome Characterization Initiative

Visit the database of genomic characterization data for multiple tumor types.


Library Info Page


Library ID

Library Name:Sugano mouse brain mncb
Organism:Mus musculus
Strain:C57BL
UniGene Library ID:1469
Tissue Description:
Library Keywords:normal, bulk, adult, EST, female, size fractionated, plasmid vector, oligo-dT primed, whole brain, C57/BL

Clones and Sequences

#Clones Generated to Date:
#Sequences Generated to Date:5523

Library Preparation Details

Description:1st strand cDNA was primed with an oligo(dT) primer ATGTGGCCTTTTTTTTTTTTTTTTT]; double-stranded cDNA was ligated to a DraIII adaptor [TGTTGGCCTACTGG], digested and cloned into distinct DraIII sites of the pME18S-FL3. XhoI sites just outside the DraIII sites can be used to isolate the cDNA insert. Size selection was performed to exclude fragments <1.5 kb. Library was constructed by Sugano et al.(University of Tokyo, Institute of Medical Science). Custom primer used for sequencing: 5' end primer [CTTCTGCTCTAAAAGCTGCG], 3' end primer [CGACCTGCAGCTCGAGCACA]
R. Site1:
R. Site2:
Lab Host:TOP10
Vector:pME18S-FL3
Vector Type:
Tissue Supplier:
Library Producer: