Skip Navigation
NCI banner National Cancer Institute U.S. National Institutes of Health National Cancer Institute
Tissues
  • Tools
  • SNPs by tissue
  • CGAP Data
Cancer Genome Characterization Initiative

Visit the database of genomic characterization data for multiple tumor types.


Library Info Page


Library ID

Library Name:Sugano mouse embryo mewa
Organism:Mus musculus
Strain:C57BL
UniGene Library ID:1298
Tissue Description:
Library Keywords:fetus, normal, micro-bulk, EST, embryonic tissue, size fractionated, phagemid, C57/BL

Clones and Sequences

#Clones Generated to Date:
#Sequences Generated to Date:10066

Library Preparation Details

Description:1st strand cDNA was primed with an oligo(dT) primer [ATGTGGCCTTTTTTTTTTTTTTTTT]; double-stranded cDNA was ligated to a DraIII adaptor [TGTTGGCCTACTGG], digested and cloned into distinct DraIII sites of the pME18S-FL3 vector (5' site CACTGTGTG, 3' site CACCATGTG). XhoI should be used to isolate the cDNA insert. Size selection was performed to exclude fragments <1.5kb. Library constructed by Dr. Sumio Sugano (University of Tokyo Institute of Medical Science). Custom primers for sequencing: 5' end primer CTTCTGCTCTAAAAGCTGCG and 3' end primer CGACCTGCAGCTCGAGCACA.
R. Site1:DraIII (CACTGTGTG)
R. Site2:DraIII (CACCATGTG)
Lab Host:DH10B
Vector:pME18S-FL3
Vector Type:phagemid (ampicillin resistant)
Tissue Supplier:
Library Producer: