Skip Navigation
NCI banner National Cancer Institute U.S. National Institutes of Health National Cancer Institute
Tissues
  • Tools
  • SNPs by tissue
  • CGAP Data
Cancer Genome Characterization Initiative

Visit the database of genomic characterization data for multiple tumor types.


Library Info Page


Library ID

Library Name:Ko mouse embryo 11 5dpc
Organism:Mus musculus
Strain:C57BL/6J
UniGene Library ID:845
Tissue Description:
Library Keywords:normal, micro-bulk, normalized, EST, embryonic tissue, mixed pool by gender, size fractionated, plasmid vector, oligo-dT primed, C57BL/6J, organogenesis

Clones and Sequences

#Clones Generated to Date:
#Sequences Generated to Date:3040

Library Preparation Details

Description:Total RNAs were extracted from 11.5 dpc embryos (excluding placenta and yolk sac). The double-stranded cDNA was synthesized with an oligo (dT)-1 primer GAGAGAGACTAGTTCTAGATCGCGAGCGGCCGCTTTTTTTTTTTTTTTTTT 3'. The cDNAs were ligated to LL-Sal3A: 5' GCTATTGACGTCGACTATCC 3' and LL-Sal3B: 5' GGATAGTCGACGTCAAT 3'. The cDNAs were size-selected and amplified by long-range PCR using Ex Taq polymerase for 18 cycles. The PCR-amplifiable cDNA mixture went through one round of equalization and was digested with SalI/NotI and cloned into the SalI/NotI sites of the pSPORT1 plasmid vector (Life Technologies). The library was constructed by Dr. Minoru S. H. Ko and Dr. Xiaohong Wang.
R. Site1:SalI
R. Site2:NotI
Lab Host:DH10B
Vector:pSPORT1
Vector Type:phagemid (ampicillin resistant)
Tissue Supplier:
Library Producer: