Skip Navigation
NCI banner National Cancer Institute U.S. National Institutes of Health National Cancer Institute
Tissues
  • Tools
  • SNPs by tissue
  • CGAP Data
Cancer Genome Characterization Initiative

Visit the database of genomic characterization data for multiple tumor types.


Library Info Page


Library ID

Library Name:NIH_MGC_35
Organism:Homo sapiens
UniGene Library ID:4010
Tissue Description:Cervix, carcinoma
Library Keywords:cervix, non-normalized, cell line, EST, unknown developmental stage, MGC, female, plasmid vector, directionally cloned, oligo-dT primed, cervical adenocarcinoma

Clones and Sequences

#Clones Generated to Date:4992
#Sequences Generated to Date:307

Other Libraries from Same Tissue Sample

NIH_MGC_4

Library Preparation Details

Description:cDNA made by oligo-dT priming. Directionally cloned into CeuI/SceI sites using the following 5' adaptor: taactataacggtcctaaggtagcga and 3' adaptor: tttcattacctctttctccgcaccccacataaa. Average insert size 1.8kb. Library prepared by Edge BioSystems.
R. Site1:SceI
R. Site2:CeuI
Lab Host:DH10B (phage-resistant)
Vector:pOTB7a
Vector Type:plasmid (chloramphenicol resistant, grown at 30C)
Tissue Supplier:
Library Producer:Edge BioSystems