Skip Navigation
NCI banner National Cancer Institute U.S. National Institutes of Health National Cancer Institute
Tissues
  • Tools
  • SNPs by tissue
  • CGAP Data
Cancer Genome Characterization Initiative

Visit the database of genomic characterization data for multiple tumor types.


Library Info Page


Library ID

Library Name:NIH_MGC_260
Organism:Homo sapiens
UniGene Library ID:16958
Tissue Description:Embryonic stem cells, isolated from the Inner Cell Mass of Blastocyst stage embryos, BG01, Markers:- SSEA1-, SSEA3+, SSEA4+, Tra 1-60+, Tra 1-81+, CD9+, Alk Phos+, Oct4+, Nanog+, Passage number:- 21
Library Keywords:normal, non-normalized, cell line, EST, embryonic stem cell, MGC, embryonic tissue, male, unknown embryonic stage, hESBGN-01

Clones and Sequences

#Clones Generated to Date:9984
#Sequences Generated to Date:9050

Library Preparation Details

Description:RNA obtained from human embryonic stem cells isolated from the inner cell mass of blastocyst stage embryos. Cell line id and NIH Registry designation is BGO1. Positive for SSEA3, SSEA4, Tra 1-60, Tra 1-81, CD9, Alk Phos, Oct4 and Nanog expression; negative for SSEA1 expression. Passage number 21. cDNA primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. This primary library is non-normalized (normalized primary library is NIH_MGC_261). It was constructed by Express Genomics (Frederick, MD). Sequence ends have been trimmed to exclude vector and regions below Phred quality 16. Note: this is a Mammalian Gene Collection library.
R. Site1:NotI
R. Site2:EcoRV
Lab Host:DH10B-T1 phage-resistant E. coli
Vector:pExpress-1
Vector Type:Plasmid
Tissue Supplier:
Library Producer:Express Genomics