Skip Navigation
NCI banner National Cancer Institute U.S. National Institutes of Health National Cancer Institute
  • Tools
  • SNPs by tissue
  • CGAP Data
Cancer Genome Characterization Initiative

Visit the database of genomic characterization data for multiple tumor types.

Library Info Page

Library ID

Library Name:NIH_MGC_279
Organism:Homo sapiens
UniGene Library ID:16678
Tissue Description:Embryonic stem cells, cell line(HSF-1.14, NIH Registry designation UC01) derived from blastocyst stage embryo cells. Inner cell mass of blastocyst.
Library Keywords:normal, cell line, normalized, blastocyst, EST, embryonic stem cell, MGC, embryonic tissue, size fractionated, plasmid vector, HSF1

Clones and Sequences

#Clones Generated to Date:9984
#Sequences Generated to Date:4110

Library Preparation Details

Description:RNA obtained from pluripotent cell line derived from blastocyst inner cell mass (cell line HSF-1.14, NIH Registry designation UC01. Positive for OCT4 expression by rtPCR, positive for SSEA-3, SSEA-4, Tra-1-81, Tra-1-60 by immunofluorescence. Negative for SSEA-1 by immunofluorescence. Passage 35. This line is a subclone of the parental line; the parental line was subcloned to remove aneuploid cells). cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.25 kb resulted in an average insert size of 1.82 kb. This primary library is normalized (non-normalized primary library is NIH_MGC_278) and was constructed by Express Genomics (Frederick, MD). Note: this is a Mammalian Gene Collection library.
R. Site1:EcoRV
R. Site2:NotI
Lab Host:DH10B TonA
Vector Type:plasmid
Tissue Supplier:
Library Producer:Express Genomics