Skip Navigation
NCI banner National Cancer Institute U.S. National Institutes of Health National Cancer Institute
Tissues
  • Tools
  • SNPs by tissue
  • CGAP Data
Cancer Genome Characterization Initiative

Visit the database of genomic characterization data for multiple tumor types.


Library Info Page


Library ID

Library Name:NIH_MGC_258
Organism:Homo sapiens
UniGene Library ID:16754
Tissue Description:Embryonic stem cells, isolated from the Inner Cell Mass of Blastocyst stage embryos and differentiated to an early endodermal cell type, BG01, Markers:- GATA4+, MixL1+, Msx1+, HNF4alpha+, AFP-, Passage number:- 40
Library Keywords:normal, non-normalized, cell line, blastocyst, EST, embryonic stem cell, MGC, endoderm, male, plasmid vector, hESBGN-01

Clones and Sequences

#Clones Generated to Date:9984
#Sequences Generated to Date:8819

Library Preparation Details

Description:RNA obtained from human embryonic stem cells isolated from the inner cell mass of blastocyst stage embryos and differentiated to an early endodermal cell type. Cell line id and NIH Registry designation is BGO1. Positive for GATA4, MixL1, Msx1, HNF4alpha expression; negative for AFP expression. Passage number 40. cDNA primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. This primary library is non-normalized (normalized primary library is NIH_MGC_259). It was constructed by Express Genomics (Frederick, MD). Sequence ends have been trimmed to exclude vector and regions below Phred quality 16. Three-prime sequences are presented as their reverse complement and have been trimmed to exclude polyA. Note: this is a Mammalian Gene Collection library.
R. Site1:NotI
R. Site2:EcoRV
Lab Host:DH10B-T1 phage-resistant E. coli
Vector:pExpress-1
Vector Type:Plasmid
Tissue Supplier:
Library Producer:Express Genomics