Skip Navigation
NCI banner National Cancer Institute U.S. National Institutes of Health National Cancer Institute
  • Tools
  • SNPs by tissue
  • CGAP Data
Cancer Genome Characterization Initiative

Visit the database of genomic characterization data for multiple tumor types.

Library Info Page

Library ID

Library Name:Human primary human ocular pericytes. Unamplified (hw)
Organism:Homo sapiens
UniGene Library ID:15616
Tissue Description:
Library Keywords:eye, normal, non-normalized, cell line, adult, EST, pericyte, plasmid vector, directionally cloned

Clones and Sequences

#Clones Generated to Date:
#Sequences Generated to Date:3538

Library Preparation Details

Description:RNA was extracted from primary human pericytes in culture. A directionally cloned cDNA library in the pSPORT1 vector (Invitrogen) was constructed at Bioserve Biotechnology (Laurel MD) essentially following the protocols of the SuperScript Plasmid System full details of which are contained in the manufacturer's Instruction manual ( First strand synthesis was carried out using a Not I primer-adapter [5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)15-3']. cDNA was cloned in Not I/Sal I sites. EST analysis was performed at the NIH Intramural Sequencing Center (NISC).
R. Site1:
R. Site2:
Lab Host:EMDH10B
Vector Type:Plasmid
Tissue Supplier:
Library Producer: