Skip Navigation
NCI banner National Cancer Institute U.S. National Institutes of Health National Cancer Institute
  • Tools
  • SNPs by tissue
  • CGAP Data
Cancer Genome Characterization Initiative

Visit the database of genomic characterization data for multiple tumor types.

Library Info Page

Library ID

Library Name:NIH_MGC_221
Organism:Homo sapiens
UniGene Library ID:14495
Tissue Description:Chondrosarcoma, myxoid chondrosarcoma Grade II, mixture of 3 cell lines, enriched for 4-5 Kb mRNA
Library Keywords:non-normalized, chondrosarcoma, cell line, adult, EST, grade II, unknown developmental stage, mixed tissue, MGC, size fractionated, plasmid vector, directionally cloned, oligo-dT primed

Clones and Sequences

#Clones Generated to Date:1152
#Sequences Generated to Date:792

Library Preparation Details

Description:Library is oligo-dT primed and directionally cloned Denatured RNA was size fractionated on a 1% agarose gel. First strand cDNA synthesis was primed with oligo-dT primer containing a Not I site. Double strand cDNA was size selected according tomRNA size fraction, ligated with EcoR I adaptor, digested with Not I and then cloned directionally into pYX-Asc vector. Average insert size 4-5Kb. Adaptors 5'(AATTCGGCACGAGG)3' and 5'd (CCTCGTGCCG)3'. 3' Linker sequence - GCGGCCGCTGAGAGCC T18. Sequencing primers 3'end: T3 promoter primer 5'd (ATTAACCCTCACTAAAGGGA)3'. 5' End: T7 promoter primer 5'd (TAATACGACTCACTATAGGG)3'. Library was constructed in the laboratory of M. Bento Soares. Note: this is a NIH_MGC Library
R. Site1:EcoRI
R. Site2:NotI
Lab Host:DH10B TonA
Vector Type:plasmid
Tissue Supplier:
Library Producer:M. Bento Soares, University of Iowa