Skip Navigation
NCI banner National Cancer Institute U.S. National Institutes of Health National Cancer Institute
Tissues
  • Tools
  • SNPs by tissue
  • CGAP Data
Cancer Genome Characterization Initiative

Visit the database of genomic characterization data for multiple tumor types.


Library Info Page


Library ID

Library Name:Human Retina cDNA (Un-normalized, unamplified): hd/he
Organism:Homo sapiens
UniGene Library ID:10966
Tissue Description:
Library Keywords:retina, normal, bulk, adult, EST, plasmid vector, directionally cloned

Clones and Sequences

#Clones Generated to Date:
#Sequences Generated to Date:4914

Library Preparation Details

Description:Neural retina tissue was dissected from two 80 year old donors with no observed eye disease. 100ug of total RNA was used for library construction. A directionally cloned cDNA library in the pSPORT1 vector (Life Technologies) was constructed at Bioserve Biotechnology (Laurel MD) essentially following the protocols of the SuperScript Plasmid System full details of which are contained in the manufacturer's Instruction manual (http://www.lifetech.com/). First strand synthesis was carried out using a Not I primer-adapter [5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)15-3']. EST analysis was performed on the unamplified library at the NIH Intramural Sequencing Center (NISC).
R. Site1:
R. Site2:
Lab Host:EMDH10B
Vector:pSPORT1
Vector Type:Plasmid
Tissue Supplier:
Library Producer: