Skip Navigation
NCI banner National Cancer Institute U.S. National Institutes of Health National Cancer Institute
Tissues
  • Tools
  • SNPs by tissue
  • CGAP Data
Cancer Genome Characterization Initiative

Visit the database of genomic characterization data for multiple tumor types.


Library Info Page


Library ID

Library Name:Human Iris cDNA (Un-normalized, unamplified): BX
Organism:Homo sapiens
UniGene Library ID:7316
Tissue Description:
Library Keywords:normal, bulk, EST, iris, mixed developmental stages, plasmid vector

Clones and Sequences

#Clones Generated to Date:
#Sequences Generated to Date:2001

Library Preparation Details

Description:Post-mortem iris tissue was pooled from 10 individuals ranging in age from 4-80 years and RNA was extracted. From this pooled sample an aliquot of 60ug of total RNA yielded 2.17ug of mRNA. A directionally cloned cDNA library in the pCMVSPORT6 vector was constructed at Life Technologies, essentially following the protocols of the SuperScript Plasmid System full details of which are contained in the manufacturer's Instruction manual (http://www.lifetech.com/). First strand synthesis was carried out using a Not I primer-adapter [5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)15-3']. Not I/blunt end inserts were cloned into the Not I/EcoR V sites in the vector. EST analysis was performed on the unamplified library at the NIH Intramural Sequencing Center (NISC).
R. Site1:
R. Site2:
Lab Host:EMDH10B
Vector:pCMVSPORT6
Vector Type:Plasmid
Tissue Supplier:
Library Producer: