Skip Navigation
NCI banner National Cancer Institute U.S. National Institutes of Health National Cancer Institute
Tissues
  • Tools
  • SNPs by tissue
  • CGAP Data
Cancer Genome Characterization Initiative

Visit the database of genomic characterization data for multiple tumor types.


Library Info Page


Library ID

Library Name:Human Lens cDNA (Un-normalized, unamplified): BY
Organism:Homo sapiens
UniGene Library ID:7315
Tissue Description:
Library Keywords:normal, bulk, adult, lens, EST, plasmid vector

Clones and Sequences

#Clones Generated to Date:
#Sequences Generated to Date:1377

Library Preparation Details

Description:Two human lenses from different adults (both approximately 40 years old) together yielded 20ug of total RNA and 150ng mRNA for cDNA library synthesis. A directionally cloned cDNA library in the pCMVSPORT6 vector was constructed at Life Technologies, essentially following the protocols of the SuperScript Plasmid System full details of which are contained in the manufacturer's Instruction manual (http://www.lifetech.com/). First strand synthesis was carried out using a Not I primer-adapter [5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)15-3']. Not I/blunt end inserts were cloned into the Not I/EcoR V sites in the vector. EST analysis was performed on the unamplified library at the NIH Intramural Sequencing Center (NISC).
R. Site1:
R. Site2:
Lab Host:EMDH10B
Vector:pCMVSPORT6
Vector Type:Plasmid
Tissue Supplier:
Library Producer: