Skip Navigation
NCI banner National Cancer Institute U.S. National Institutes of Health National Cancer Institute
Tissues
  • Tools
  • SNPs by tissue
  • CGAP Data
Cancer Genome Characterization Initiative

Visit the database of genomic characterization data for multiple tumor types.


Library Info Page


Library ID

Library Name:Pediatric pre-B cell acute lymphoblastic leukemia Baylor-HGSC project=TCBA
Organism:Homo sapiens
UniGene Library ID:5411
Tissue Description:
Library Keywords:lymph node, acute lymphocytic leukemia, flow-sorted, normalized, juvenile, EST, male, directionally cloned, oligo-dT primed

Clones and Sequences

#Clones Generated to Date:
#Sequences Generated to Date:9589

Library Preparation Details

Description:First strand cDNA was primed with an anchored XhoI-oligo(dT) primer [5'GGAGGACTCGAGCGGCCGCAGGAGGAG(T)VN 3'; V=A,C,G; N=A,C,G,T] and then dG tailed. Second strand was primed with a BamH1-dC primer [5'AGAGAGCTCGGATCCGCGGCCGCAATAATAATAAT(C) 3']. Double-stranded cDNA was then digested with BamH1 and XhoI and directionally cloned into the BamH1 and Sa1I sites of lambda pSB vector. Library went through one round of normalization. Library was constructed by Wei Yu at RIKEN of Japan (Carninci P, Westover A, Nishiyama Y, Ohsumi T, Itoh M, Nagaoka S, SasakiN, Okazaki Y, Muramatsu M, Schneider C, Hayashizaki Y, High efficiency selection of full-length cDNA by improved biotinylated cap trapper., DNA Res 4: 1, 61-6, Feb 28, 1997)
R. Site1:BamHI
R. Site2:EcoRI
Lab Host:DH10B
Vector:lambda pSB
Vector Type:
Tissue Supplier:
Library Producer: