Skip Navigation
NCI banner National Cancer Institute U.S. National Institutes of Health National Cancer Institute
RNAi
  • shRNA Info
Cancer Genome Characterization Initiative

Visit the database of genomic characterization data for multiple tumor types.


Genes Containing RNAi Constructs

RNAi Gene Query Results For:Hs; 6421
UniGene Build:Hs.234/Mm.193
 

Displaying 1 thru 6 of 6 items

SymbolOligo IDSequenceRNAi ViewDescriptionCGAP
COPG2V2HS_16327CCATTCCTGAGTTTCTGAAAL162012Coatomer protein complex, subunit gamma 2Gene Info
COPG2V2LHS_192300
V2LHS_16328
V2LHS_16398
CAATGACGCGATTGTTTCA
CTGTTTCCAAGATGTTGAA
GCCATTGTGGACTGTATAA
NM_012133Coatomer protein complex, subunit gamma 2Gene Info
COPG2V2HS_16327CCATTCCTGAGTTTCTGAAAK022934Coatomer protein complex, subunit gamma 2Gene Info
COPG2V2HS_16327CCATTCCTGAGTTTCTGAABC017443Coatomer protein complex, subunit gamma 2Gene Info
COPG2V2HS_16327CCATTCCTGAGTTTCTGAAAF157833Coatomer protein complex, subunit gamma 2Gene Info
COPG2V2HS_16327CCATTCCTGAGTTTCTGAABC110796Coatomer protein complex, subunit gamma 2Gene Info