Skip Navigation
NCI banner National Cancer Institute U.S. National Institutes of Health National Cancer Institute
RNAi
  • shRNA Info
Cancer Genome Characterization Initiative

Visit the database of genomic characterization data for multiple tumor types.


Genes Containing RNAi Constructs

RNAi Gene Query Results For:Hs; 506374
UniGene Build:Hs.234/Mm.193
 

Displaying 1 thru 2 of 2 items

SymbolOligo IDSequenceRNAi ViewDescriptionCGAP
NDUFA12V2HS_22185
V2LHS_22185
V2HS_22187
V2HS_22184
CACCTTACAAGTAAAGACA
CACCTTACAAGTAAAGACA
CCTTCAACACCTTACAAGT
CTTATTCTACCACTAGAAA
NM_018838NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 12Gene Info
NDUFA12V2HS_22188CTGGTTACCATTCACTATAAF112208NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 12Gene Info