Skip Navigation
NCI banner National Cancer Institute U.S. National Institutes of Health National Cancer Institute
RNAi
  • shRNA Info
Cancer Genome Characterization Initiative

Visit the database of genomic characterization data for multiple tumor types.


Genes Containing RNAi Constructs

RNAi Gene Query Results For:Hs; 331555
UniGene Build:Hs.234/Mm.193
 

Displaying 1 thru 4 of 4 items

SymbolOligo IDSequenceRNAi ViewDescriptionCGAP
SPINK5V2HS_78041CTATCTTTGTCCAAAGGATDQ149927Serine peptidase inhibitor, Kazal type 5Gene Info
SPINK5V2HS_78041CTATCTTTGTCCAAAGGATAJ228139Serine peptidase inhibitor, Kazal type 5Gene Info
SPINK5V2HS_78045CCATGAATTTCAGGCATTTNM_006846Serine peptidase inhibitor, Kazal type 5Gene Info
SPINK5V2HS_78041CTATCTTTGTCCAAAGGATDQ149928Serine peptidase inhibitor, Kazal type 5Gene Info