Skip Navigation
NCI banner National Cancer Institute U.S. National Institutes of Health National Cancer Institute
RNAi
  • shRNA Info
Cancer Genome Characterization Initiative

Visit the database of genomic characterization data for multiple tumor types.


Genes Containing RNAi Constructs

RNAi Gene Query Results For:Hs; 28988
UniGene Build:Hs.234/Mm.193
 

Displaying 1 thru 5 of 5 items

SymbolOligo IDSequenceRNAi ViewDescriptionCGAP
GLRXV2HS_191971GAGTCTTTATCGGTAAAGAD21238Glutaredoxin (thioltransferase)Gene Info
GLRXV2HS_191971GAGTCTTTATCGGTAAAGABC106075Glutaredoxin (thioltransferase)Gene Info
GLRXV2HS_25119
V2LHS_25191
GACCCAATTGGAGAAATCA
GGAACACTCTGTTATTTAA
NM_002064Glutaredoxin (thioltransferase)Gene Info
GLRXV2LHS_25191GGAACACTCTGTTATTTAANM_001118890Glutaredoxin (thioltransferase)Gene Info
GLRXV2HS_191971GAGTCTTTATCGGTAAAGAAF162769Glutaredoxin (thioltransferase)Gene Info